Quote
Email Us
Citations Search

GBP6 maintains mitochondrial bioenergetics to promote immune evasion from NK cells in cervical cancer

Abstract

Oligonucleotides human GBP6 shRNA#1: CGATGAGCTAACTGCAATATT Tsingke Biotechnology N/A human GBP6 shRNA#2: CCGATGAGCTAACTGCAATAT Tsingke Biotechnology N/A human GBP6 sgRNA#…


Custom DNA Oligo





Article Link >


Contact Us
Explore the power of the Gene Factory and discover how Tsingke's integrated platform accelerates your R&D and product development.
Tsingke Updates
Tsingke Updates
Scaling Oligo Supply for IVD Development: A Buyer’s Checklist
2026-09-28
Scaling Oligo Supply for IVD Development: A Buyer’s Checklist
How to Order Custom Oligos: A Practical Guide to Sequence, Modification, Purification, and QC
2026-09-28
How to Order Custom Oligos: A Practical Guide to Sequence, Modification, Purification, and QC
pop_close
pop_main
Subscribe to Our Newsletter

Stay updated with the latest industry news and expert insights. 

Subscribe now to receive:
        ● Industry updates
        ● Exclusive expert insights and analysis
Enter your email to stay ahead!

ISO9001: 2015
ISO13485: 2016
Products
ISO9001: 2015
ISO13485: 2016
Gene Factory
Applications
QUICK LINK
Contacts
Copyright © Beijing Tsingke Biotech Co., Ltd. All Rights Reserved.
Sitemap Privacy Policy
We use cookies to offer you a better browsing experience, analyze site traffic and personalize content. Part of the tracking is necessary to ensure SEO effectiveness,
By using this site, you agree to our use of cookies. Visit our cookie policy to learn more.
Reject Accept