Quote
Email Us
Citations Search

Time-series transcriptome profiling of liver regeneration in ALLPS models of mice identifies the Cyp8b1 as a potential target for hepatocyte proliferation

Abstract

AML12 cell lines were authenticated by STR profiling. Specific small interfering RNA (siRNA) (5′-3′, GGGUGGUACAGGAGGAUUAUG) targeting Cyp8b1 was synthesized by Tsingke Biotechnology. Cells were transfected with siRNA using Genmute™ Reagent (SignaGen Laboratories, Cat# SL100568) following the manufacturer's protocol.


Products & Services

siRNA



Article Link >

Contact Us
Explore the power of the Gene Factory and discover how Tsingke's integrated platform accelerates your R&D and product development.
Tsingke Updates
pop_close
pop_main
Subscribe to Our Newsletter

Stay updated with the latest industry news and expert insights. 

Subscribe now to receive:
        ● Industry updates
        ● Exclusive expert insights and analysis
Enter your email to stay ahead!

We use cookies to offer you a better browsing experience, analyze site traffic and personalize content. Part of the tracking is necessary to ensure SEO effectiveness,
By using this site, you agree to our use of cookies. Visit our cookie policy to learn more.
Reject Accept