DNA substrates The following 27-nt DNA oligos were synthesized in Tsingke Biotechnology or Genscript Biotech for biochemical and structural experiments: 27ATrich_s: AACTTTCTTAACATCTTAACTTTAACT (numbered as dA-13–dT13 with the target site dA0 in the MTA1cMTA9–hmDNA complex structure) 27ATrich_6mA_s: AACTTTCTTAAC(m6dA)TCTTAACTTTAACT 27ATrich_a: AGTTAAAGTTAAGATGTTAAGAAAGTT 27ATrich_6mA_a: AGTTAAAGTTAAG(m6dA)TGTTAAGAAAGTT (numbered as dA-13’–dT13’ in the MTA1cMTA9–hmDNA complex structure) 27ATrich_Cy5.5_a: Cy5.5-AGTTAAAGTTAAGATGTTAAGAAAGTT 27ATrich_6FAM_a: 6-FAM-AGTTAAAGTTAAGATGTTAAGAAAGTT 27_RNA_a: AGUUAAAGUUAAGAUGUUAAGAAAGUU These oligos were dissolved in 30 mM HEPES, pH 7.5, 100 mM KCl. Complementary oligos were mixed with an equal molar ratio, heated to 95 °C for 5 min, and then slowly cooled down to room temperature.
Stay updated with the latest industry news and expert insights.
Subscribe now to receive:
● Industry updates
● Exclusive expert insights and analysis
Enter your email to stay ahead!
