Quote
Email Us
Citations Search

Rhein Inhibits Podocyte Ferroptosis and Epithelial-Mesenchymal Transition in Diabetic Nephropathy by Activating the SIRT1/p53/SLC7A11 Pathway

Abstract

Relative mRNA expression was normalized to β-actin using the 2−ΔΔCt method. Primers were synthesized by Beijing Qingke and used as follows: Mouse α-SMA (ACTA2) Forward (F): 5'-GCCCCTGAAGAGCATCCGAC-3'; ACTA2 Reverse (R): 5'-CCAGAGTCCAGCACAATACCAGT-3', Mouse collagen I (COL1A1) F: 5'-CTGGTGCTCG CGGTAACGAT-3'; COL1A1 R: 5'-CAGCACCAGGGTTTCCAGCA-3', Mouse fibronectin (FN1) F: 5'-GATGTCCGAACAGCTATTTACCA-3'; FN1 R: 5'-CCTTGCGACTTCAGCCACT-3', Mouse SIRT1 F: 5'-TTCTATACCCCATGAAGTGCCTC-3'; SIRT1 R: 5'-CACCACCTAGCCTATGACACA-3', Mouse SLC7A11 F: 5'-CATACTCCAGAACACGGGCAG-3'; SLC7A11 R: 5'-AACAAAAGCCAGCAAAGGACCA-3', Mouse p53 (TP53) F: TCCTCCCCAGCATCTTATCCG; TP53 R: CCATGCAGGAGCTATTACACA, and Mouse β-actin F: 5'-ACATCCGTAAAGACCTCTATGCC-3'; β-actin R: 5'-TACTCCTGCTTGCTGATCCAC-3'.


Products & Services

Custom DNA Oligo



Article Link >

Contact Us
Explore the power of the Gene Factory and discover how Tsingke's integrated platform accelerates your R&D and product development.
Tsingke Updates
pop_close
pop_main
Subscribe to Our Newsletter

Stay updated with the latest industry news and expert insights. 

Subscribe now to receive:
        ● Industry updates
        ● Exclusive expert insights and analysis
Enter your email to stay ahead!

We use cookies to offer you a better browsing experience, analyze site traffic and personalize content. Part of the tracking is necessary to ensure SEO effectiveness,
By using this site, you agree to our use of cookies. Visit our cookie policy to learn more.
Reject Accept