Plasmid recombination DNA oligonucleotides (oligos) corresponding to the coding sequences (Table S11) of the PPARG gene were synthesized by Tsingke Biotechnology (Beijing, China), and ligated into pcDNA3.1(+) vector (Promega, USA) between the KpnI and XhoI sites (OE-PPARG). The blank pcDNA3.1(+) vector (OE-NC) acts as a negative control. To evaluate the potential effect on gene expression activity of one 653 bp DBI-specifically accessible region (Chr2:198163303-198163955, Oar_rambouillet_v1.0), the fragments covering the DBI-Peak were amplified with forward primer (GGTCACCTCAGAGCTTCCTC) and reverse primer (AGATTGCTGCCTAAGAGCAGAG), which targeted Chr2:198163003-198164255 in Tan sheep DNA samples. The PCR products were then Sanger-sequenced. Finally, DNA oligos corresponding to the DBI-Peak were synthesized by Tsingke Biotechnology (Beijing, China), and ligated into the pGL3-Promoter vector (Promega, Madison, USA) between the MluI and XhoI enzyme sites (pDBI-Peak). The blank pGL3-Promoter vector (pBlank) was used as a negative control for the pDBI-Peak.
Stay updated with the latest industry news and expert insights.
Subscribe now to receive:
● Industry updates
● Exclusive expert insights and analysis
Enter your email to stay ahead!
