Quote
Email Us
Citations Search

Distinct Phage-Encoded Enzymes for Substitution of Deoxythymidine by Deoxyuridine in Phage Genomes

Abstract

PasI (ER1861-200 units) restriction endonuclease was purchased from Thermo Fisher. dCTP, dCDP, dCMP, CTP, dUTP, dUMP, dTTP, dTMP, dGMP, GMP, dT, and dU were purchased from Beyotime (Shanghai, China), Aladdin (Shanghai, China), and Macklin (Shanghai, China). The sgRNA1 (5′-UAAUUUCUACUAAGUGUAGAUCCGCUUGCGGUGCCAUUAAU-3′, PAM: TTTG) and sgRNA2 (5′-UAAUUUCUACUAAGUGUAGAUUGGGCUUUGGCAAUUGCAUUCAU, PAM: TTTA-3′) for LbCas12a, and the sgRNA3 (5′-UGUGAUAAAUUCAUGAAGCGCGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3′, PAM: TGG) and sgRNA4 (5′-AAAUAUCUUCGAUCCGUGGGGCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3, PAM: GGG) for SpCas9 were synthesized by Tsingke Biotechnology. UV/UV–vis spectroscopic measurements were made using a NANODROP ONE (Thermo SCIENTIFIC), or using a Biotek Synergy 2 reader for 96-well plates.


Products & Services

sgRNA



Article Link >

Contact Us
Explore the power of the Gene Factory and discover how Tsingke's integrated platform accelerates your R&D and product development.
Tsingke Updates
pop_close
pop_main
Subscribe to Our Newsletter

Stay updated with the latest industry news and expert insights. 

Subscribe now to receive:
        ● Industry updates
        ● Exclusive expert insights and analysis
Enter your email to stay ahead!

We use cookies to offer you a better browsing experience, analyze site traffic and personalize content. Part of the tracking is necessary to ensure SEO effectiveness,
By using this site, you agree to our use of cookies. Visit our cookie policy to learn more.
Reject Accept