RNA isolation and quantitative reverse transcription-polymerase chain reaction (qRT-PCR) Total RNA isolation, qRT-PCR, and data analysis were performed as described previously [40]. All primers were synthesized by Tsingke Biotechnology (Beijing, China) with sequences as below: Human IL-8: Forward: 5’- TGCCAAGGAGTGCTAAAG -3’, Reverse: 5’- TCTCAGCCCTCTTCAAAA -3’; Human FOS: Forward: 5’- TAGCAAAACGCATGGAGTGT -3’, Reverse: 5’- GCCTGGCTCAACATGCTACT -3’; Human eIF4E: Forward: 5’- CCTACAGAACAGATGGGCACTC -3’, Reverse: 5’- GCCCAAAAGTCTTCAACAGTATCA -3’; Human GAPDH: Forward: 5’-ATGGGGAAGGTGAAGGTCG-3’, Reverse: 5’-GGGGTCATTGATGGCAACAACAATA-3’.
Stay updated with the latest industry news and expert insights.
Subscribe now to receive:
● Industry updates
● Exclusive expert insights and analysis
Enter your email to stay ahead!
