The CMV enhancer-MCS-3flag-polyA-EF1A-zsGreen-sv40-puromycin vector (GeneChem, China) was used to overexpress IRP1, ARID3A, and CYGB. Gene-specific siRNAs and nonsense control were provided by Tsingke Biotechnology Co., Ltd., Beijing, China. The target two sequences for IRP1 knockdown were CCAGGAAAGAAATTCTTCAAT and CCTGCTGATCTTGTAATAGAT.
Stay updated with the latest industry news and expert insights.
Subscribe now to receive:
● Industry updates
● Exclusive expert insights and analysis
Enter your email to stay ahead!
